Product Data Sheet

Standard heat-shock transformation of chemically competent bacteria

1. Take competent cells out of -80°C and thaw on ice.
2. Take agar plates (containing the appropriate antibiotic) out of 4°C to warm up to room temperature or place in 37°C incubator.
3. Mix 5μl of DNA into 100μL competent cells in a microcentrifuge or falcon tube. GENTLY mix by flicking the bottom of the tube with your finger a few times.
4. Place the competent cell/DNA mixture on ice for 20-30min.
5. Heat shock each transformation tube by placing the bottom 2/3 of the tube into a 42°C water bath for 42 seconds. Put the tubes back on ice for 2 min.
6. Add 250-500μl SOC media (without antibiotic) and grow in 37°C shaking incubator for 45min.
7. Plate all of the transformation onto a 10cm LB agar plate containing the appropriate antibiotic.
8. Incubate plates at 37°C overnight.

Reference

FullText

Size  4542 bp

Origin of Replication

pMB1

Notes

araC 96..974 compl. ( TTATGA.+CAGCCAT )

AraC binding site 1 1002..1019 ( agaaaccaattgtccata )

AraC binding site 2 1140..1157 ( taacaaaagtgtctataa )

AraC binding site 3 1160..1177 ( acggcagaaaagtccaca )

AraC binding site 4 1214..1231 ( tagcatttttatccataa )

AraC-arabinose binding site 1234..1251 ( ttagcggatcctacctga )

CRP binding site 1182..1203 ( ttatttgcacggcgtcacactt )

pBAD promoter 1250..1277 ( gacgctttttatcgcaactctctactgt )

transcription start site 1286

polylinker 1300..1366 ( )

optimized RBS 1306..1311 ( aggagg )

Kozak sequence 1317..1319 ( acc )

rrnB terminator 1572..1775 ( ataaaac.+ggccttttt )

bla 1885..2745 ( ATGAGTATTCAACA.+GATTAAGCATTGGTAA )

M13 ori 2784..3242 ( tttacgcgccc.+ttacaattt )

pBR ori 3248..3945 ( gatctaggtgaa.+atggaaaaacg )

TUNEology 波长可调检测卡盒-->